Como fazer primers de nucleotídeos para PCR

Escrito por mark wallen | Traduzido por ricardo torres iupi
  • Compartilhar
  • Tweetar
  • Compartilhar
  • Pin
  • E-mail
Como fazer primers de nucleotídeos para PCR
A reação em cadeia da polimerase é uma maneira de amplificar pequenas quantidades de DNA (DNA image by Allyson Ricketts from

Para que a reação em cadeia da polimerase possa amplificar fragmentos de DNA corretamente, você precisa de dois primers devidamente produzidos, ou sequencias curtas de nucleotídeos que são complementares à primeira parte do segmento de DNA que está sendo copiado. O PCR é usado para uma variedade de aplicações que vão desde a execução da lei até engenharia genética. Ele toma uma amostra de DNA de cadeia dupla, quebra-o em cadeias separadas, anexa os primers às cadeias simples, e depois estende os primers para formar duas peças de DNA de cadeia dupla. Esse processo é repetido de modo a obter uma amostra de concentração várias vezes maior que a original.

O próximo primer que você utilizar deve combinar-se com o DNA no lado oposto, ou à cadeia complementar. Em outras palavras, ele deve compreender com os primeiros nucleotídeos de sua seqüência de interesse. O primer inverso tem que se ligar ao fim do seu gene de interesse e imitar sua cadeia complementar.

Nível de dificuldade:
Moderadamente desafiante


  1. 1

    Usando um processador de informações ou um programa mais especializado para estudos de DNA, olhe para a seqüência que se deseja amplificar. Anote os primeiros 18-24 pares de bases e os últimos 18-24 pares de bases. Eles não devem ser encontrados em outros lugares na sua amostra de DNA, o que pode ser comum para as áreas que se repetem. Se isso acontecer, você vai acabar com seu primer de ligação à várias áreas da sua amostra e os resultados do PCR terão comprimentos variáveis.

  2. 2

    Anote o primeiro e o último segmento de DNA que você estava olhando na primeira etapa. Por exemplo, vamos dizer que a seqüência de início era ATGGAATTCACGATCGATCGT e a última foi GGGTGCGAACACGGACTTAG. Neste exemplo, estamos ampliando um gene em particular do início ao fim.

  3. 3

    Pegue a primeira seqüência de 18-24 pares de bases (no exemplo, é ATGGAATTCACGATCGATCGT) e a insira em outro documento para fazer o próximo primer. Salve com o nome da região que está sendo amplificada e anote que esse é um primer avançado.

  4. 4

    Anote os últimas 18-24 pares de bases da sequência de interesse (GGGTGCGAACACGGACTTAG no exemplo) para criar o primer reverso. Escreva os nucleótidos complementares dessa sequência, representando o outro lado. Cada uma das quatro bases de um nucleotídeo pareia com uma única base: adenina (A) com timina (T) e citosina (C) com guanina (G). Uma vez que você tenha a outra cadeia complementar, você deve inverter a ordem de todos os nucleotídeos da cadeia reescrevendo-a na direção oposta. Quando isso for concluído, pegue sua sequência recém-complementada e invertida, salve-a em um documento devidamente rotulado.

  5. 5

    Acesse o site de seu fornecedor e insira a sequência com a conta de faturamento relevante (geralmente ligado a um laboratório), a concentração e outras modificações especiais. Faça seu pedido.

Dicas & Advertências

  • Este processo pode gastar várias tentativas até o acerto. Entretanto, primers podem ser caros, por isso sempre verifique-os com muita atenção e esteja acompanhado por alguém mais experiente nas primeiras vezes.
  • Não misture as sequências de diferentes amostras. Só é preciso uma pequena mistura nos arquivos para fazermos o primer errado para amostra de errada.
  • Esteja atento pois não é só por causa que alguém lhe deu uma amostra de DNA e lhe disse que uma sequência x estava lá dentro, que isso a torna verdade. Se foi comprado de uma empresa, você pode ter mais confiança, porém erros ainda podem acontecer.

Não perca

  • Geral
  • Artigos
  • Slides
  • Vídeos
  • Mais relevantes
  • Mais lidos
  • Mais recentes

Nenhum artigo disponível

Nenhum slide disponível

Nenhum vídeo disponível