Mais
×

Como fazer primers de nucleotídeos para PCR

Atualizado em 22 julho, 2017

Para que a reação em cadeia da polimerase possa amplificar fragmentos de DNA corretamente, você precisa de dois primers devidamente produzidos, ou sequencias curtas de nucleotídeos que são complementares à primeira parte do segmento de DNA que está sendo copiado. O PCR é usado para uma variedade de aplicações que vão desde a execução da lei até engenharia genética. Ele toma uma amostra de DNA de cadeia dupla, quebra-o em cadeias separadas, anexa os primers às cadeias simples, e depois estende os primers para formar duas peças de DNA de cadeia dupla. Esse processo é repetido de modo a obter uma amostra de concentração várias vezes maior que a original.

O próximo primer que você utilizar deve combinar-se com o DNA no lado oposto, ou à cadeia complementar. Em outras palavras, ele deve compreender com os primeiros nucleotídeos de sua seqüência de interesse. O primer inverso tem que se ligar ao fim do seu gene de interesse e imitar sua cadeia complementar.

Instruções

A reação em cadeia da polimerase é uma maneira de amplificar pequenas quantidades de DNA (DNA image by Allyson Ricketts from Fotolia.com)
  1. Usando um processador de informações ou um programa mais especializado para estudos de DNA, olhe para a seqüência que se deseja amplificar. Anote os primeiros 18-24 pares de bases e os últimos 18-24 pares de bases. Eles não devem ser encontrados em outros lugares na sua amostra de DNA, o que pode ser comum para as áreas que se repetem. Se isso acontecer, você vai acabar com seu primer de ligação à várias áreas da sua amostra e os resultados do PCR terão comprimentos variáveis.

  2. Anote o primeiro e o último segmento de DNA que você estava olhando na primeira etapa. Por exemplo, vamos dizer que a seqüência de início era ATGGAATTCACGATCGATCGT e a última foi GGGTGCGAACACGGACTTAG. Neste exemplo, estamos ampliando um gene em particular do início ao fim.

  3. Pegue a primeira seqüência de 18-24 pares de bases (no exemplo, é ATGGAATTCACGATCGATCGT) e a insira em outro documento para fazer o próximo primer. Salve com o nome da região que está sendo amplificada e anote que esse é um primer avançado.

  4. Anote os últimas 18-24 pares de bases da sequência de interesse (GGGTGCGAACACGGACTTAG no exemplo) para criar o primer reverso. Escreva os nucleótidos complementares dessa sequência, representando o outro lado. Cada uma das quatro bases de um nucleotídeo pareia com uma única base: adenina (A) com timina (T) e citosina (C) com guanina (G). Uma vez que você tenha a outra cadeia complementar, você deve inverter a ordem de todos os nucleotídeos da cadeia reescrevendo-a na direção oposta. Quando isso for concluído, pegue sua sequência recém-complementada e invertida, salve-a em um documento devidamente rotulado.

  5. Acesse o site de seu fornecedor e insira a sequência com a conta de faturamento relevante (geralmente ligado a um laboratório), a concentração e outras modificações especiais. Faça seu pedido.

Dicas

  • Este processo pode gastar várias tentativas até o acerto. Entretanto, primers podem ser caros, por isso sempre verifique-os com muita atenção e esteja acompanhado por alguém mais experiente nas primeiras vezes.

Aviso

  • Não misture as sequências de diferentes amostras. Só é preciso uma pequena mistura nos arquivos para fazermos o primer errado para amostra de errada.
  • Esteja atento pois não é só por causa que alguém lhe deu uma amostra de DNA e lhe disse que uma sequência x estava lá dentro, que isso a torna verdade. Se foi comprado de uma empresa, você pode ter mais confiança, porém erros ainda podem acontecer.
Cite this Article A tool to create a citation to reference this article Cite this Article